Skip to main content
Addgene
Open Menu

pGL3-1574/+120
(Plasmid #35539)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 35539 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 35539-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 35539-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pGL3-basic
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 4818
  • Total vector size (bp) 6503
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    promoter region of miR200b-200a-429 genomic cluster
  • Alt name
    MIRN200B
  • Alt name
    MIRN200A
  • Alt name
    MIRN429
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1694
  • GenBank ID
    406984 406983
  • Entrez Gene
    MIR200B (a.k.a. MIRN200B, mir-200b)
  • Entrez Gene
    MIR429 (a.k.a. MIRN429, hsa-mir-429, mir-429)
  • Entrez Gene
    MIR200A (a.k.a. MIRN200A, mir-200a)
  • Promoter none
  • Tag / Fusion Protein
    • luciferase (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BglI (not destroyed)
  • 5′ sequencing primer -CTAGCAAAATAGGCTGTCCC
  • 3′ sequencing primer CTTTATGTTTTTGGCGTCTTCCA
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that Addgene's sequencing results identified a few nucleotide mismatches at bp# 253, 457, 465, 632, 681 & 1463 when compared to the sequence provided by the depositing laboratory. These differences are not known to affect the function of the plasmid.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3-1574/+120 was a gift from Greg Goodall (Addgene plasmid # 35539 ; http://n2t.net/addgene:35539 ; RRID:Addgene_35539)

  • For your References section:

    A double-negative feedback loop between ZEB1-SIP1 and the microRNA-200 family regulates epithelial-mesenchymal transition. Bracken CP, Gregory PA, Kolesnikoff N, Bert AG, Wang J, Shannon MF, Goodall GJ. Cancer Res. 2008 Oct 1;68(19):7846-54. 10.1158/0008-5472.CAN-08-1942 PubMed 18829540
Related items:
Commonly requested with: