Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pHiKdtA
(Plasmid #36269)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 36269 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    H. influenzae KdtA
  • Promoter araC

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NedI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer 5’-GCAGCATATGTGGCGTTTTTTTTATACCAGCTTGC- 3’
  • 3′ sequencing primer 5’- GCAGAAGCTTTCATACATTGCGCTCCAAATAAGGTTTT -3'
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHiKdtA was a gift from Christian Raetz (Addgene plasmid # 36269 ; http://n2t.net/addgene:36269 ; RRID:Addgene_36269)
  • For your References section:

    Interchangeable domains in the Kdo transferases of Escherichia coli and Haemophilus influenzae. Chung HS, Raetz CR. Biochemistry. 2010 May 18;49(19):4126-37. 10.1021/bi100343e PubMed 20394418