Skip to main content

pIS1-Vim5UTR-renilla
(Plasmid #38237)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 38237 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 38237-D50 50 μg of DNA in Tris buffer $495
DNA 38237-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pIS1
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 5000
  • Modifications to backbone
    Vector promoter was replaced with genomic mouse Vim promoter (1000 nt upstream of predicted transcriptional start site).
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Vim 5'UTR / Renilla
  • Alt name
    Vim
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1000
  • Mutation
    Vim 5' UTR fused to renilla ORF
  • Entrez Gene
    Vim
  • Promoter Endogenous Vim

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site Nhe1 (not destroyed)
  • 5′ sequencing primer gggctcgctgggtcctaggct
  • 3′ sequencing primer CATCCGTTTCCTTTGTTCTGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIS1-Vim5UTR-renilla was a gift from David Sabatini (Addgene plasmid # 38237 ; http://n2t.net/addgene:38237 ; RRID:Addgene_38237)
  • For your References section:

    A unifying model for mTORC1-mediated regulation of mRNA translation. Thoreen CC, Chantranupong L, Keys HR, Wang T, Gray NS, Sabatini DM. Nature. 2012 May 2;485(7396):109-13. doi: 10.1038/nature11083. 10.1038/nature11083 PubMed 22552098