Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pIS1-Eef25UTR-TOPmut-renilla
(Plasmid #38236)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 38236 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pIS1
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 5000
  • Modifications to backbone
    Vector promoter was removed and replaced with the genomic mouse Eef2 promoter.
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Eef2_TOPm_5UTR/Renilla
  • Alt name
    Eef2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2000
  • Mutation
    The first nucleotides of the 5' UTR were changed from CTCTTCC to CAGGAAG
  • Entrez Gene
    Eef2 (a.k.a. Ef-2)
  • Promoter Endogenous Eef2

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nco1 (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer gggctcgctgggtcctaggct
  • 3′ sequencing primer CATCCGTTTCCTTTGTTCTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIS1-Eef25UTR-TOPmut-renilla was a gift from David Sabatini (Addgene plasmid # 38236 ; http://n2t.net/addgene:38236 ; RRID:Addgene_38236)
  • For your References section:

    A unifying model for mTORC1-mediated regulation of mRNA translation. Thoreen CC, Chantranupong L, Keys HR, Wang T, Gray NS, Sabatini DM. Nature. 2012 May 2;485(7396):109-13. doi: 10.1038/nature11083. 10.1038/nature11083 PubMed 22552098