Skip to main content

SV-ABAactDA
(Plasmid #38247)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 38247 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 38247-D50 50 μg of DNA in Tris buffer $495
DNA 38247-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pUC
  • Backbone manufacturer
    homemade
  • Backbone size w/o insert (bp) 2944
  • Total vector size (bp) 2944
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    VP16/PYL1
  • Species
    A. thaliana (mustard weed)
  • Promoter SV40p
  • Tags / Fusion Proteins
    • VP16 (N terminal on insert)
    • HA (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site Spe1 (not destroyed)
  • 3′ cloning site EcoR1 (not destroyed)
  • 5′ sequencing primer GTGAGCGGATAACAATTTCAC
  • 3′ sequencing primer CCC TCA CAT TGC CAA AAG AC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Gal4DBD/ABI*
  • Species
    A. thaliana (mustard weed)
  • Mutation
    D143A
  • Promoter SV40 (IRES)
  • Tags / Fusion Proteins
    • Gal4DBD (N terminal on insert)
    • Flag (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sac1 (not destroyed)
  • 3′ cloning site Not1 (not destroyed)
  • 5′ sequencing primer GCACATGCTTTACATGTGTTTAG
  • 3′ sequencing primer gtg agc gga taa caa ttt cac
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that there are minor sequence discrepancies between depositor's reference sequence and Addgene's quality control sequence. These changes are in backbone region only and should not affect function.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SV-ABAactDA was a gift from Jerry Crabtree (Addgene plasmid # 38247 ; http://n2t.net/addgene:38247 ; RRID:Addgene_38247)
  • For your References section:

    Engineering the ABA plant stress pathway for regulation of induced proximity. Liang FS, Ho WQ, Crabtree GR. Sci Signal. 2011 Mar 15;4(164):rs2. 10.1126/scisignal.2001449 PubMed 21406691