pMXs-puro GFP-p62 L343A
(Plasmid #38279)

• Depositing Lab: Noboru Mizushima
• Publication: Itakura et al J Cell Biol. 2011 Jan 10;192(1):17-27.

Backbone

• Vector backbone: pMXs-puro
• Backbone manufacturer: Dr. Toshio Kitamura of the University of Tokyo
• Backbone size w/o insert (bp): 6878
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Sequestosome-1
• Alt name: p62
• Alt name: Sqstm1
• Species: M. musculus (mouse)
• Insert Size (bp): 1300
• Mutation: changed L343A
• GenBank ID: U57413
• Entrez Gene: Sqstm1 (a.k.a. A170, OSF-6, Osi, STAP, STONE14, p62)
• Tag / Fusion Protein:
  • EGFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CGACCACTACCAGCAGAACA
• 3′ sequencing primer: AAAATTAGTCAGCCATGGGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: p62 cDNA was provied by Dr. Masaaki Komatsu (Tokyo Metropolitan Institute of Medical Science, Tokyo, Japan).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Ichimura et al., JBC 2008 283, 22847