Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pRAJ11-12
(Plasmid #39258)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 39258 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRAJ12
  • Backbone manufacturer
    Jaramillo Lab
  • Backbone size w/o insert (bp) 5153
  • Total vector size (bp) 5248
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    transRAJ11+cisRAJ12
  • Promoter pLlacO-1+pLtetO-1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site NheI (destroyed during cloning)
  • 5′ sequencing primer tgccacctgacgtctaagaa
  • 3′ sequencing primer attaccgcctttgagtgagc
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRAJ11-12 was a gift from Alfonso Jaramillo (Addgene plasmid # 39258 ; http://n2t.net/addgene:39258 ; RRID:Addgene_39258)
  • For your References section:

    De novo automated design of small RNA circuits for engineering synthetic riboregulation in living cells. Rodrigo G, Landrain TE, Jaramillo A. Proc Natl Acad Sci U S A. 2012 Sep 18;109(38):15271-6. Epub 2012 Sep 4. 10.1073/pnas.1203831109 PubMed 22949707