pGEX4T-1 hSlp4-a W118S
(Plasmid
#40065)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 40065 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGEX4T-1
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4900
- Total vector size (bp) 6900
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsExpression in BL21 with IPTG
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehSlp4-a W118S
-
Alt nameSynaptotagmin-like protein 4-a
-
Alt nameSlp4-a W118S
-
Alt nameGranuphilin
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2025
-
MutationTryptophane 118 to Serine
-
GenBank IDNM_080737
-
Entrez GeneSYTL4 (a.k.a. SLP4)
- Promoter Tac
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX4T-1 hSlp4-a W118S was a gift from Fernando Martin-Belmonte (Addgene plasmid # 40065 ; http://n2t.net/addgene:40065 ; RRID:Addgene_40065) -
For your References section:
Synaptotagmin-like proteins control the formation of a single apical membrane domain in epithelial cells. Galvez-Santisteban M, Rodriguez-Fraticelli AE, Bryant DM, Vergarajauregui S, Yasuda T, Banon-Rodriguez I, Bernascone I, Datta A, Spivak N, Young K, Slim CL, Brakeman PR, Fukuda M, Mostov KE, Martin-Belmonte F. Nat Cell Biol. 2012 Jul 22. doi: 10.1038/ncb2541. 10.1038/ncb2541 PubMed 22820376