pLMB509
(Plasmid #40084)

• Depositing Lab: Philip Poole
• Publication: Tett et al Appl Environ Microbiol. 2012 Oct;78(19):7137-40. Epub 2012 Jul 20.

Backbone

• Vector backbone: pBBRMCS5
• Backbone size w/o insert (bp): 4768
• Total vector size (bp): 6879
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Gentamicin, 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: gfpmut 3.1
• Species: jellyfish
• Insert Size (bp): 884

Cloning Information for Gene/Insert 1

• Cloning method: TOPO Cloning
• 5′ sequencing primer: cttcctatctggatataagg

Gene/Insert 2

• Gene/Insert name: tauR
• Species: Sinorhizobium meliloti
• Insert Size (bp): 1473

Cloning Information for Gene/Insert 2

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CCAGTTGGGCGAGGTGAACA

Gene/Insert 3

• Gene/Insert name: tau promoter
• Species: Sinorhizobium meliloti
• Insert Size (bp): 157

Cloning Information for Gene/Insert 3

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: cgcggatctgcgcctgcagg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

GenBank accession number: JQ895027

pLMB509 contains GFPmut3.1 reporter gene downstream of the inducible promoter tauAp and a ribosomal binding site (RBS), followed by a six-His tag and a transcriptional stop codon. NdeI restriction sites flank the reporter gene, enabling the easy removal of gfpmut3.1 and subsequent replacement with the desired gene in frame.

This plasmid is compatible with BD In-Fusion cloning (Clontech) for the cloning of genes containing NdeI restriction sites