-
Depositing Lab
-
Depositing OrganizationIndiana University School of Medicine, Indianapolis
Located in United States of America -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 40346 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 40346-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 40346-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCXN2
-
Backbone manufacturerNiwa, Yamamura, and Miyazaki (PMID: 1660837)
- Backbone size w/o insert (bp) 5200
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBCL6
-
Alt nameBCL-6
-
Alt nameB-cell CLL/lymphoma 6
-
SpeciesH. sapiens (human)
-
Entrez GeneBCL6 (a.k.a. BCL5, BCL6A, LAZ3, ZBTB27, ZNF51)
- Promoter pCAG
-
Tag
/ Fusion Protein
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI/SalI (destroyed during cloning)
- 3′ cloning site SalI/XhoI (destroyed during cloning)
- 5′ sequencing primer pCAG-F
- 3′ sequencing primer Bglob-pA-R (ttttggcagagggaaaaaga)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
CXN-BCL-6 was constructed by inserting the human BCL-6 cDNA from pBS-BCL-6 full length (FL) via SalI ends into the XhoI site in the pCXN2 expression vector. The pCXN2 (CXN) vector was obtained from Dr. K. Ozato (National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD) and consists of the human BCL-6 cDNA driven by a hybrid β-actin-CMV promoter.
DNA (Catalog # 40346-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 40346-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCXN2-BCL6 (CXN-BCL6) was a gift from Alexander Dent (Addgene plasmid # 40346 ; http://n2t.net/addgene:40346 ; RRID:Addgene_40346) -
For your References section:
Repression of AP-1 function: a mechanism for the regulation of Blimp-1 expression and B lymphocyte differentiation by the B cell lymphoma-6 protooncogene. Vasanwala FH, Kusam S, Toney LM, Dent AL. J Immunol. 2002 Aug 15;169(4):1922-9. PubMed 12165517
