pKXUa1-HA-ATBF1
(Plasmid
#40926)
-
Depositing Lab
-
Depositing OrganizationEmory University
Located in United States of America -
Citations
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 40926 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 40926-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 40926-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepKXUa1
-
Backbone manufacturerKaiming Xu (Emory University)
- Backbone size w/o insert (bp) 6750
- Total vector size (bp) 19000
-
Modifications to backbonea linker containing HA-tag was inserted
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameATBF1
-
Alt nameZFHX3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)11112
-
GenBank IDL32832.1 AAC14462.1
-
Entrez GeneZFHX3 (a.k.a. ATBF1, ATBT, ATFB8, C16orf47, SCA4, ZFH-3, ZNF927)
- Promoter CMV
-
Tag
/ Fusion Protein
- HA (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (unknown if destroyed)
- 3′ cloning site SalI (unknown if destroyed)
- 5′ sequencing primer GCAAATGGGCGGTAGGCGTGTA
- 3′ sequencing primer GACCTTGCATTCCTTTGGCGAGAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 40926-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 40926-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKXUa1-HA-ATBF1 was a gift from Jin-Tang Dong (Addgene plasmid # 40926 ; http://n2t.net/addgene:40926 ; RRID:Addgene_40926) -
For your References section:
ATBF1 inhibits estrogen receptor (ER) function by selectively competing with AIB1 for binding to the ER in ER-positive breast cancer cells. Dong XY, Sun X, Guo P, Li Q, Sasahara M, Ishii Y, Dong JT. J Biol Chem. 2010 Oct 22;285(43):32801-9. Epub 2010 Aug 18. 10.1074/jbc.M110.128330 PubMed 20720010