Skip to main content
Addgene
Open Menu

pCW57.1
(Plasmid #41393)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 41393 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    pCW57.1
  • Backbone size (bp) 9354
  • Vector type
    Mammalian Expression, Lentiviral ; Gateway Destination vector, Doxycycline inducible
  • Promoter TRE promoter, Tet ON
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Growth instructions
    Note that this plasmid grows slowly. Liquid cultures may need to be incubated up to two days for substantial growth.
  • Copy number
    Unknown

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer LNCX
  • 3′ sequencing primer O.PGK1b-R (GAACGGACGTGAAGAATGTG)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The plasmid expresses rtTA-VP16-2A-puro from the PGK promoter, so it can be used as an 'all-in-one' dox on system.

Alternate plasid names:
pLIX_401
TRE-gateway; PGK-rtTA-2A-puro

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW57.1 was a gift from David Root (Addgene plasmid # 41393 ; http://n2t.net/addgene:41393 ; RRID:Addgene_41393)

Ready-to-use antibodies

Looking for antibodies related to this plasmid? Check out these options:

Learn More
Related items:
Commonly requested with: