Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCW57.1
(Plasmid #41393)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 41393 Standard format: Plasmid sent in bacteria as agar stab 1 $75
Cloning Grade DNA 41393-DNA.cg 2 µg of cloning grade DNA in Tris buffer 1 $95

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCW57.1
  • Backbone size (bp) 9354
  • Vector type
    Mammalian Expression, Lentiviral ; Gateway Destination vector, Doxycycline inducible
  • Promoter TRE promoter, Tet ON
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Growth instructions
    Note that this plasmid grows slowly. Liquid cultures may need to be incubated up to two days for substantial growth.
  • Copy number
    Unknown

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer LNCX
  • 3′ sequencing primer O.PGK1b-R (GAACGGACGTGAAGAATGTG)
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

The plasmid expresses rtTA-VP16-2A-puro from the PGK promoter, so it can be used as an 'all-in-one' dox on system.

Alternate plasid names:
pLIX_401
TRE-gateway; PGK-rtTA-2A-puro

Information for Cloning Grade DNA (Catalog # 41393-DNA.cg) ( Back to top )

Purpose

Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.

Delivery

  • Amount 2 µg
  • Guaranteed Concentration 100 ng/µl +/- 5 ng/µl
  • Pricing $95 USD
  • Storage DNA can be stored at 4℃ (short term) or -20℃ (long term).

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Quality Control

Addgene has verified this plasmid using Next Generation Sequencing. Results are available here

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW57.1 was a gift from David Root (Addgene plasmid # 41393 ; http://n2t.net/addgene:41393 ; RRID:Addgene_41393)