pRP
(Plasmid #41841)

• Purpose: (Empty Backbone)
• Depositing Lab: Eicke Latz
• Publication: Stutz et al Methods Mol Biol. 2013;1040:91-101. doi: 10.1007/978-1-62703-523-1_8.

Backbone

• Vector backbone: pCDNA3
• Backbone manufacturer: Invitrogen
• Backbone size (bp): 6577
• Modifications to backbone: Part of the SV40 Promotor (Leaving the SV40 Enhancer) through the Neomycin resistance gene in pCDNA3 was removed by digesting with BstZ17 I & Avr II (filled in to blunt), and self-ligating. This was digested with Not I then partially with Xmn I, and the MoMLV 3’ UTR was PCR cloned in with Not I & Xmn I. This was digested with Nru I & BamH I, and PCRed CMV/MoMLV 5'LTR cut with Nru I & BspE I, and PCRed LNGFR cut with BspE I & BamH I were cloned together. This was digested with BamH I & Not I, and PCRed CMV cut with BamH I & HinD III, and annealed oligonucleotde Polylinker with HinD III & Not I overhangs were ligated together. LNGFR was removed with BspE I & BamH I and replaced with PCRed puromycin resistance cut with Age I & Bgl II.
• Vector type: Mammalian Expression, Retroviral
• Promoter: CMV
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: AAGCAGAGCTCGTTTAGTGAA
• 3′ sequencing primer: CTTGCAAAATGGCGTTACTTA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The retroviral insert in this vector was made by PCRing CMV and MoMLV elements from pCLNCX (Naviaux et al. J Virol. 1996 August; 70(8): 5701–5705.) and recloning them into a modified pCDNA3 backbone
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry