Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLuc-CDS-m215-2
(Plasmid #42102)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 42102 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    psiCHECK-1
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 3565
  • Total vector size (bp) 6940
  • Modifications to backbone
    The stop codon of Renilla luciferase was removed, and a SalI restriction site was added by PCR.
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ZEB1
  • Species
    H. sapiens (human)
  • Mutation
    Silent mutations were introduced in the seed-complementary site of dsEcad215 antisense strand (215a-2).
  • GenBank ID
    NM_030751.4
  • Promoter SV40
  • Tag / Fusion Protein
    • Renilla luciferase (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGCAACTACAACGCCTACCT
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLuc-CDS-m215-2 was a gift from Kumiko Ui-Tei (Addgene plasmid # 42102 ; http://n2t.net/addgene:42102 ; RRID:Addgene_42102)
  • For your References section:

    E-cadherin is transcriptionally activated via suppression of ZEB1 transcriptional repressor by small RNA-mediated gene silencing. Mazda M, Nishi K, Naito Y, Ui-Tei K. PLoS One. 2011;6(12):e28688. doi: 10.1371/journal.pone.0028688. Epub 2011 Dec 21. 10.1371/journal.pone.0028688 PubMed 22205962