-
Depositing Lab
-
Depositing OrganizationUniversitaet des Saarlandes
Located in Germany -
Citations
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 42175 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 42175-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 42175-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.1/CT-GFP TOPO
-
Backbone manufacturerinvitrogen
- Backbone size w/o insert (bp) 6157
- Total vector size (bp) 7828
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameInsulin-like growth factor 2 mRNA binding protein 2-2
-
Alt nameIMP2-2, p62, IGF2BP2-2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1671
-
GenBank IDNM_001007225.1
-
Entrez GeneIGF2BP2 (a.k.a. IMP-2, IMP2, VICKZ2)
- Promoter T7
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GGGTAAGCTTTCCGTATGTAGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 42175-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 42175-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3-GFP-IMP2-2 was a gift from Alexandra Kiemer (Addgene plasmid # 42175 ; http://n2t.net/addgene:42175 ; RRID:Addgene_42175) -
For your References section:
IGF2 mRNA binding protein p62/IMP2-2 in hepatocellular carcinoma: antiapoptotic action is independent of IGF2/PI3K signaling. Kessler SM, Pokorny J, Zimmer V, Laggai S, Lammert F, Bohle RM, Kiemer AK. Am J Physiol Gastrointest Liver Physiol. 2013 Feb 15;304(4):G328-36. doi: 10.1152/ajpgi.00005.2012. Epub 2012 Dec 20. 10.1152/ajpgi.00005.2012 PubMed 23257922