-
PurposeA genetically encoded sensor for H2O2 with expanded dynamic range.
-
Depositing Lab
-
Depositing OrganizationShemyakin-Ovchinnikov Institute of Bioorganic Chemistry (INACTIVE)
Located in Russian Federation -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 42211 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepC1
- Backbone size w/o insert (bp) 3982
- Total vector size (bp) 5419
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHYPER 2
-
SpeciesSynthetic
-
Insert Size (bp)1437
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer cggtgggaggtctatataag
- 3′ sequencing primer tgggaggttttttaaagcaag
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pC1-HyPer-2 was a gift from Vsevolod Belousov (Addgene plasmid # 42211 ; http://n2t.net/addgene:42211 ; RRID:Addgene_42211) -
For your References section:
A genetically encoded sensor for H2O2 with expanded dynamic range. Markvicheva KN, Bilan DS, Mishina NM, Gorokhovatsky AY, Vinokurov LM, Lukyanov S, Belousov VV. Bioorg Med Chem. 2011 Feb 1;19(3):1079-84. doi: 10.1016/j.bmc.2010.07.014. Epub 2010 Aug 5. 10.1016/j.bmc.2010.07.014 PubMed 20692175