-
PurposeGenetically encoded fluorescent indicator for simultaneous PIP3 and hydrogen peroxide detection.
-
Depositing Lab
-
Depositing OrganizationShemyakin-Ovchinnikov Institute of Bioorganic Chemistry
Located in the Russian Federation -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 42212 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 42212-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 42212-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepC1
- Backbone size w/o insert (bp) 3931
- Total vector size (bp) 5896
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePIP-SHOW
-
Alt nameBTK-HYPER
-
SpeciesSynthetic
-
Insert Size (bp)1965
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer cggtgggaggtctatataag
- 3′ sequencing primer tgggaggttttttaaagcaag
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 42212-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 42212-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pC1-PIP-SHOW was a gift from Vsevolod Belousov (Addgene plasmid # 42212 ; http://n2t.net/addgene:42212 ; RRID:Addgene_42212) -
For your References section:
Can we see PIP(3) and hydrogen peroxide with a single probe?. Mishina NM, Bogeski I, Bolotin DA, Hoth M, Niemeyer BA, Schultz C, Zagaynova EV, Lukyanov S, Belousov VV. Antioxid Redox Signal. 2012 Aug 1;17(3):505-12. doi: 10.1089/ars.2012.4574. Epub 2012 Apr 10. 10.1089/ars.2012.4574 PubMed 22369174