Skip to main content
Addgene
Open Menu

pHes1(2.5k)-luc
(Plasmid #43806)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 43806 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 43806-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 43806-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pGL2-Basic
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 5597
  • Total vector size (bp) 8200
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Hes1 Promoter
  • Alt name
    Hes1
  • Alt name
    hairy and enhancer of split 1 Promoter
  • Alt name
    hairy and enhancer of split 1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2500
  • Mutation
    Contains the murine Hes1 promoter
  • GenBank ID
    NC_000082.6
  • Entrez Gene
    Hes1 (a.k.a. Hry, bHLHb39)
  • Promoter Hes1 Promoter
  • Tag / Fusion Protein
    • Firefly luciferase (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer F1ori-F (GTGGACTCTTGTTCCAAACTGG)
  • 3′ sequencing primer LucNrev
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    PGL2-Basic (under designation "Picagene Basic Vector") obtained from Toyo Ink (Tokyo, Japan).

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHes1(2.5k)-luc was a gift from Ryoichiro Kageyama (Addgene plasmid # 43806 ; http://n2t.net/addgene:43806 ; RRID:Addgene_43806)

  • For your References section:

    Structure, chromosomal locus, and promoter analysis of the gene encoding the mouse helix-loop-helix factor HES-1. Negative autoregulation through the multiple N box elements. Takebayashi K, Sasai Y, Sakai Y, Watanabe T, Nakanishi S, Kageyama R. J Biol Chem. 1994 Feb 18;269(7):5150-6. PubMed 7906273
Related items:
Commonly requested with: