Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Hes5-Luc
(Plasmid #41724)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 41724 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGL2-Basic
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 5597
  • Total vector size (bp) 6470
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Hes5 Promoter
  • Alt name
    Hes5
  • Alt name
    hairy and enhancer of split 5 Promoter
  • Alt name
    hairy and enhancer of split 5
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    873
  • Mutation
    Contains the murine Hes5 promoter (-800 to +73)
  • GenBank ID
    NC_000070.6
  • Promoter Hes5
  • Tag / Fusion Protein
    • Firefly luciferase (C terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer F1ori-F (GTGGACTCTTGTTCCAAACTGG)
  • 3′ sequencing primer LucNrev
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Hes5-Luc was a gift from Ryoichiro Kageyama & Raphael Kopan (Addgene plasmid # 41724 ; http://n2t.net/addgene:41724 ; RRID:Addgene_41724)
  • For your References section:

    Structure, chromosomal locus, and promoter of mouse Hes2 gene, a homologue of Drosophila hairy and Enhancer of split. Nishimura M, Isaka F, Ishibashi M, Tomita K, Tsuda H, Nakanishi S, Kageyama R. Genomics. 1998 Apr 1;49(1):69-75. 10.1006/geno.1998.5213 PubMed 9570950