Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pHes1(2.5k)-luc
(Plasmid #43806)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 43806 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGL2-Basic
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 5597
  • Total vector size (bp) 8200
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Hes1 Promoter
  • Alt name
    Hes1
  • Alt name
    hairy and enhancer of split 1 Promoter
  • Alt name
    hairy and enhancer of split 1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2500
  • Mutation
    Contains the murine Hes1 promoter
  • GenBank ID
    NC_000082.6
  • Entrez Gene
    Hes1 (a.k.a. Hry, bHLHb39)
  • Promoter Hes1 Promoter
  • Tag / Fusion Protein
    • Firefly luciferase (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer F1ori-F (GTGGACTCTTGTTCCAAACTGG)
  • 3′ sequencing primer LucNrev
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    PGL2-Basic (under designation "Picagene Basic Vector") obtained from Toyo Ink (Tokyo, Japan).
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHes1(2.5k)-luc was a gift from Ryoichiro Kageyama (Addgene plasmid # 43806 ; http://n2t.net/addgene:43806 ; RRID:Addgene_43806)
  • For your References section:

    Structure, chromosomal locus, and promoter analysis of the gene encoding the mouse helix-loop-helix factor HES-1. Negative autoregulation through the multiple N box elements. Takebayashi K, Sasai Y, Sakai Y, Watanabe T, Nakanishi S, Kageyama R. J Biol Chem. 1994 Feb 18;269(7):5150-6. PubMed 7906273