-
Depositing Lab
-
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 43806 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepGL2-Basic
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 5597
- Total vector size (bp) 8200
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHes1 Promoter
-
Alt nameHes1
-
Alt namehairy and enhancer of split 1 Promoter
-
Alt namehairy and enhancer of split 1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2500
-
MutationContains the murine Hes1 promoter
-
GenBank IDNC_000082.6
-
Entrez GeneHes1 (a.k.a. Hry, bHLHb39)
- Promoter Hes1 Promoter
-
Tag
/ Fusion Protein
- Firefly luciferase (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer F1ori-F (GTGGACTCTTGTTCCAAACTGG)
- 3′ sequencing primer LucNrev
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPGL2-Basic (under designation "Picagene Basic Vector") obtained from Toyo Ink (Tokyo, Japan).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHes1(2.5k)-luc was a gift from Ryoichiro Kageyama (Addgene plasmid # 43806 ; http://n2t.net/addgene:43806 ; RRID:Addgene_43806) -
For your References section:
Structure, chromosomal locus, and promoter analysis of the gene encoding the mouse helix-loop-helix factor HES-1. Negative autoregulation through the multiple N box elements. Takebayashi K, Sasai Y, Sakai Y, Watanabe T, Nakanishi S, Kageyama R. J Biol Chem. 1994 Feb 18;269(7):5150-6. PubMed 7906273