Skip to main content

EJ2GFP-puro
(Plasmid #44025)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 44025 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 44025-D50 50 μg of DNA in Tris buffer $495
DNA 44025-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pgkPURO
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    EJ2GFP egfp-based chromosomal break reporter
  • Species
    Synthetic
  • Mutation
    insertion of I-SceI, 3 frame stop, and flanking microhomology
  • GenBank ID
    U55761.1
  • Promoter pCAGGS

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ttcctacagctcctgggcaacg
  • 3′ sequencing primer ttttggcagagggaaaaaga
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

I-SceI-based chromosomal break reporter for Alt-EJ / MMEJ. Repair of an I-SceI-induced chromosomal break by Alt-EJ restores a GFP expression cassette. Linearize with HpaI for chromosomal integration.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EJ2GFP-puro was a gift from Jeremy Stark (Addgene plasmid # 44025 ; http://n2t.net/addgene:44025 ; RRID:Addgene_44025)
  • For your References section:

    Alternative-NHEJ is a mechanistically distinct pathway of mammalian chromosome break repair. Bennardo N, Cheng A, Huang N, Stark JM. PLoS Genet. 2008 Jun 27;4(6):e1000110. doi: 10.1371/journal.pgen.1000110. 10.1371/journal.pgen.1000110 PubMed 18584027