-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 44026 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonep59 pim targeting vector
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEJ5GFP egfp-based chromosomal break reporter
-
SpeciesSynthetic
-
MutationpCAGGS promoter and eGFP separated by pgkPURO cassette flanked by two I-SceI sites
-
GenBank IDU55761.1
- Promoter pCAGGS
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ttcctacagctcctgggcaacg
- 3′ sequencing primer ttttggcagagggaaaaaga (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Reporter for NHEJ. I-SceI-based chromosomal break reporter for end joining. End joining between two distal tandem I-SceI recognition sites restores an eGFP expression cassette, causing deletion of the intervening pgkPURO cassette. Linearize with XhoI for integration into any mammalian cell type. Also contains a promoter-less HYG gene and targeting arms to select for targeted integration to the mouse pim1 locus.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pimEJ5GFP was a gift from Jeremy Stark (Addgene plasmid # 44026 ; http://n2t.net/addgene:44026 ; RRID:Addgene_44026) -
For your References section:
Alternative-NHEJ is a mechanistically distinct pathway of mammalian chromosome break repair. Bennardo N, Cheng A, Huang N, Stark JM. PLoS Genet. 2008 Jun 27;4(6):e1000110. doi: 10.1371/journal.pgen.1000110. 10.1371/journal.pgen.1000110 PubMed 18584027