Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pimEJ5GFP
(Plasmid #44026)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 44026 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    EJ5GFP egfp-based chromosomal break reporter
  • Species
    Synthetic
  • Mutation
    pCAGGS promoter and eGFP separated by pgkPURO cassette flanked by two I-SceI sites
  • GenBank ID
    U55761.1
  • Promoter pCAGGS

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ttcctacagctcctgggcaacg
  • 3′ sequencing primer ttttggcagagggaaaaaga
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Reporter for NHEJ. I-SceI-based chromosomal break reporter for end joining. End joining between two distal tandem I-SceI recognition sites restores an eGFP expression cassette, causing deletion of the intervening pgkPURO cassette. Linearize with XhoI for integration into any mammalian cell type. Also contains a promoter-less HYG gene and targeting arms to select for targeted integration to the mouse pim1 locus.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pimEJ5GFP was a gift from Jeremy Stark (Addgene plasmid # 44026 ; http://n2t.net/addgene:44026 ; RRID:Addgene_44026)
  • For your References section:

    Alternative-NHEJ is a mechanistically distinct pathway of mammalian chromosome break repair. Bennardo N, Cheng A, Huang N, Stark JM. PLoS Genet. 2008 Jun 27;4(6):e1000110. doi: 10.1371/journal.pgen.1000110. 10.1371/journal.pgen.1000110 PubMed 18584027