Skip to main content
Addgene
Open Menu

pGL4.75-KRAS LCS6m
(Plasmid #44571)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 44571 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 44571-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 44571-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pGL4.75
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 4281
  • Total vector size (bp) 8181
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KRAS 3'UTR
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3900
  • Mutation
    The T allele at LCS6 (let-7 complementary site 6) was changed to the G allele (rs61764370 T>G)
  • GenBank ID
    NM_004985.3
  • Entrez Gene
    KRAS (a.k.a. 'C-K-RAS, C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, K-Ras, K-Ras 2, KI-RAS, KRAS1, KRAS2, NS, NS3, OES, RALD, RALD2, RASK2, c-Ki-ras, c-Ki-ras2)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xba1 (destroyed during cloning)
  • 3′ cloning site xba1 (destroyed during cloning)
  • 5′ sequencing primer TGACACAGGGAGACTACATTTAATTC
  • 3′ sequencing primer GCCTGAACTAGTTCACAGACAAGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

A substitute for pGL3-KRAS LCS6m in Chin et al., 2008.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL4.75-KRAS LCS6m was a gift from Frank Slack (Addgene plasmid # 44571 ; http://n2t.net/addgene:44571 ; RRID:Addgene_44571)
Related items:
Commonly requested with: