Skip to main content

pDN-D2irTN6kwh
(Plasmid #44724)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 44724 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 44724-D50 50 μg of DNA in Tris buffer $495
DNA 44724-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pcDNA6/TR
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 6662
  • Total vector size (bp) 6757
  • Modifications to backbone
    CMV promoter replaced with pCMV-D2i promoter. Rabbit β-globin intron and TetR replaced with new Rabbit β-globin intron-TetR::NLS-WPRE fragment.
  • Vector type
    Mammalian Expression, Synthetic Biology ; Expression regulator/reporter; Expression "Linearizer" system
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    pCMV-D2i promoter
  • Alt name
    Modified CMV-based synthetic promoter containing two tetO2 sites
  • Species
    Synthetic
  • Insert Size (bp)
    672
  • Mutation
    Initiator motif (Inr) displaced relative to pCMV-2xtetO (returned to its natural position). Two tetO2 sites flanking Inr motif.
  • Promoter pCMV-D2i

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site AflII (not destroyed)
  • 5′ sequencing primer Amp-R
  • 3′ sequencing primer Bglob-intron-R (TTTGCCCCCTCCATATAACA)
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    htetR::NLS
  • Alt name
    humanized tetracycline repressor
  • Alt name
    Simian virus 40 (SV40) large-T-antigen nuclear localization sequence
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    1740
  • Mutation
    Region around the ATG translation start codon converted to the consensus Kozak sequence; sequence optimized for mammalian codon bias
  • Tags / Fusion Proteins
    • Rabbit β-globin intron II (N terminal on insert)
    • WPRE (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer Bglob-intron-F (ctggtcatcatcctgccttt); CMV-F
  • 3′ sequencing primer WPRE-R; BGH-rev
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Fragment containing humanized htetR gene from pTet-OFF Advanced plasmid (Clontech). Fragment containing WPRE from plasmid pLVX-DD-tdTomato (Clontech). Modified CMV-based synthetic promoter pCMV-D2i synthesized de novo (Bio Basic Inc., Markham, Ontario, Canada).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDN-D2irTN6kwh was a gift from Gabor Balazsi (Addgene plasmid # 44724 ; http://n2t.net/addgene:44724 ; RRID:Addgene_44724)
  • For your References section:

    Transferring a synthetic gene circuit from yeast to mammalian cells. Nevozhay D, Zal T, Balazsi G. Nat Commun. 2013 Feb 5;4:1451. doi: 10.1038/ncomms2471. 10.1038/ncomms2471 PubMed 23385595