Skip to main content

pRSV-CaMKII(1-290)
(Plasmid #45065)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45065 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 45065-D50 50 μg of DNA in Tris buffer $495
DNA 45065-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pRSV-link
  • Backbone manufacturer
    Maurer lab
  • Backbone size w/o insert (bp) 4265
  • Total vector size (bp) 5729
  • Modifications to backbone
    Backbone derived from pRSV-globin
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CaM Kinase II
  • Alt name
    camk2
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    892
  • Mutation
    truncated at amino acid 290
  • GenBank ID
    NM_012920.1
  • Entrez Gene
    Camk2a (a.k.a. PK2CDD, PKCCD)
  • Promoter RSV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site Bgl II (destroyed during cloning)
  • 5′ sequencing primer CGATACAATAAACGCCATTTGA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRSV-CaMKII(1-290) was a gift from Richard Maurer (Addgene plasmid # 45065 ; http://n2t.net/addgene:45065 ; RRID:Addgene_45065)
  • For your References section:

    Differential activation of CREB by Ca2+/calmodulin-dependent protein kinases type II and type IV involves phosphorylation of a site that negatively regulates activity. Sun P, Enslen H, Myung PS, Maurer RA. Genes Dev. 1994 Nov 1;8(21):2527-39. 10.1101/gad.8.21.2527 PubMed 7958915