Skip to main content

pUSE-Src-KD-UniRapR-mCerulean-myc
(Plasmid #45382)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45382 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 45382-D50 50 μg of DNA in Tris buffer $495
DNA 45382-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pUSE
  • Total vector size (bp) 8612
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Src-KD-UniRapR-mCerulean-myc
  • Alt name
    Switchable Src kinase with kinase-dead mutation
  • Species
    M. musculus (mouse)
  • Mutation
    mSrc R388D (kinase dead), Y529F
  • Promoter CMV
  • Tags / Fusion Proteins
    • mCerulean (C terminal on insert)
    • myc (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUSE-Src-KD-UniRapR-mCerulean-myc was a gift from Klaus Hahn (Addgene plasmid # 45382 ; http://n2t.net/addgene:45382 ; RRID:Addgene_45382)
  • For your References section:

    Rational design of a ligand-controlled protein conformational switch. Dagliyan O, Shirvanyants D, Karginov AV, Ding F, Fee L, Chandrasekaran SN, Freisinger CM, Smolen GA, Huttenlocher A, Hahn KM, Dokholyan NV. Proc Natl Acad Sci U S A. 2013 Apr 23;110(17):6800-4. doi: 10.1073/pnas.1218319110. Epub 2013 Apr 8. 10.1073/pnas.1218319110 PubMed 23569285