pCI-EGFP-NR1 wt
(Plasmid #45446)

• Depositing Labs: Andres Barria, Robert Malinow
• Depositing Organization: Cold Spring Harbor Laboratory
  Located in United States of America
• Publication: Barria et al Neuron. 2002 Jul 18;35(2):345-53.
• Citations: 7 Articles

Backbone

• Vector backbone: pCI
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 4006
• Total vector size (bp): 8996
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: NR1
• Alt name: NMDAR1
• Alt name: Grin1
• Alt name: GluN1
• Species: R. norvegicus (rat)
• Insert Size (bp): 5000
• Mutation: EGFP inserted after the predicted signal peptide cleavage site (after amino acid residue 26)
• GenBank ID:
• Entrez Gene: Grin1 (a.k.a. GluN1, NMDAR1, NR1)
• Promoter: CMV
• Tag / Fusion Protein:
  • EGFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: T7; chim-int-F (TCTTACTGACATCCACTTTGCC)
• 3′ sequencing primer: EBV-rev

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Rat NMDA receptor genes originally cloned by Shigetada Nakanishi (PMID: 1834949)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

DNA (Catalog # 45446-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 45446-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.