Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCRII-Topo Epha3 in situ probe
(Plasmid #45627)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 45627 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCRII-Topo
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 4600
  • Vector type
    in situ

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Epha3 in situ probe
  • Alt name
    Eph receptor A3
  • Alt name
    Epha3
  • Alt name
    Hek
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    595
  • Mutation
    fragment contains bp# 3179-3773 of NM_010140
  • GenBank ID
    NM_010140
  • Entrez Gene
    Epha3 (a.k.a. AW492086, Cek4, EK4, ETK1, End3, Hek, Hek4, Mek4, Tyro4)

Cloning Information

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

The Epha3 fragment was amplified by RT-PCR using the following primer pair:
GTCCAAATGCCTTAAAATGG
CAATAGCATTTGGCACTTGG
For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation.

Please note that Addgene's sequencing results match bp# 3179-3773 of NM_010140, not bp# 3180-3774 as indicated on plasmid map. The plasmid functions as described in the associated publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRII-Topo Epha3 in situ probe was a gift from Jeffrey Macklis (Addgene plasmid # 45627 ; http://n2t.net/addgene:45627 ; RRID:Addgene_45627)
  • For your References section:

    Novel subtype-specific genes identify distinct subpopulations of callosal projection neurons. Molyneaux BJ, Arlotta P, Fame RM, MacDonald JL, MacQuarrie KL, Macklis JD. J Neurosci. 2009 Sep 30;29(39):12343-54. doi: 10.1523/JNEUROSCI.6108-08.2009. 10.1523/JNEUROSCI.6108-08.2009 PubMed 19793993