Skip to main content

5xGAL4-TATA-luciferase
(Plasmid #46756)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 46756 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 46756-D50 50 μg of DNA in Tris buffer $495
DNA 46756-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pSV232AL-AD5
  • Total vector size (bp) 6300
  • Modifications to backbone
    delete SV40 promoter and add 2xSV40 polyadenylation sits, 5xGAL4 binding sites and a minimal TATA promoter upstream of luciferase
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Luciferase
  • Species
    Firefly
  • Insert Size (bp)
    1729
  • Promoter minimal TATA

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TGTGTCAGAGGTTTTCACCGT
  • 3′ sequencing primer CGAAAAGTGCCACCTGACGTCT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    DR Helinski University of California San Diego

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

de Wet et al, MCB, 7: 725-737, 1987.

Note that there are some minor discrepancies between Addgene's quality control sequence and the depositor's assembled sequence. These differences should not affect plasmid function.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    5xGAL4-TATA-luciferase was a gift from Richard Maurer (Addgene plasmid # 46756 ; http://n2t.net/addgene:46756 ; RRID:Addgene_46756)
  • For your References section:

    Differential activation of CREB by Ca2+/calmodulin-dependent protein kinases type II and type IV involves phosphorylation of a site that negatively regulates activity. Sun P, Enslen H, Myung PS, Maurer RA. Genes Dev. 1994 Nov 1;8(21):2527-39. 10.1101/gad.8.21.2527 PubMed 7958915