pICE-EGFP-FLAG-Ku70siR-Mut6E
(Plasmid
#46962)
-
PurposeFor constitutive or doxycycline-inducible expression of mutant human Ku70 unable to bind DNA and resistant to siRNA. Confers resistance to puro. Use T-REx cells for doxycycline-inducible expression.
-
Depositing Lab
-
Depositing OrganizationGurdon Institute
Located in United Kingdom of Great Britain and Northern Ireland -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 46962 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepICE
- Backbone size w/o insert (bp) 5044
- Total vector size (bp) 7570
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKu70
-
Alt nameXRCC6
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1830
-
MutationMut6E corresponding to K282E K287E T300E K331E K338E R403E
-
GenBank IDNM_001469.3
-
Entrez GeneXRCC6 (a.k.a. CTC75, CTCBF, G22P1, KU70, ML8, TLAA)
- Promoter CMV Tet
-
Tag
/ Fusion Protein
- GFP-FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer GTAGGCGTGTACGGTGGGAGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pICE-EGFP-FLAG-Ku70siR-Mut6E was a gift from Steve Jackson (Addgene plasmid # 46962 ; http://n2t.net/addgene:46962 ; RRID:Addgene_46962) -
For your References section:
A new method for high-resolution imaging of Ku foci to decipher mechanisms of DNA double-strand break repair. Britton S, Coates J, Jackson SP. J Cell Biol. 2013 Jul 29. 10.1083/jcb.201303073 PubMed 23897892