CS2-Myc-hASUN
(Plasmid
#47955)
-
PurposeExpression of tagged-human ASUN
-
Depositing Lab
-
Depositing OrganizationVanderbilt University
Located in United States of America -
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 47955 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 47955-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 47955-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneCS2
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 7100
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAsunder
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2100
-
Entrez GeneINTS13 (a.k.a. ASUN, C12orf11, GCT1, Mat89Bb, NET48, SPATA30)
- Promoter Sp6
-
Tag
/ Fusion Protein
- Myc (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer atgaagattttttctgaatct
- 3′ sequencing primer ggaaaagccagcc ggcagtga
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 47955-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 47955-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CS2-Myc-hASUN was a gift from Laura Lee (Addgene plasmid # 47955 ; http://n2t.net/addgene:47955 ; RRID:Addgene_47955) -
For your References section:
Nuclear-localized Asunder regulates cytoplasmic dynein localization via its role in the Integrator complex. Jodoin JN, Sitaram P, Albrecht TR, May SB, Shboul M, Lee E, Reversade B, Wagner EJ, Lee LA. Mol Biol Cell. 2013 Jul 31. 10.1091/mbc.E13-05-0254 PubMed 23904267