5HT6-YC3.60
(Plasmid
#48339)
-
PurposeFRET reporter for Ca2+ inside primary cilia
-
Depositing Lab
-
Depositing OrganizationJohns Hopkins University and School of Medicine
Located in United States of America -
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 48339 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 48339-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 48339-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3
- Backbone size w/o insert (bp) 5300
- Total vector size (bp) 6650
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name5-hydroxytriptamine receptor isoform 6
-
Alt name5HT6
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1350
-
GenBank IDNM_021358
-
Entrez GeneHtr6 (a.k.a. 5-HT6)
-
Tag
/ Fusion Protein
- YC3.60 (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GGAGGTCTATATAAGCAGAGC
- 3′ sequencing primer gcacctaagctttcctcctgcgcttcctcctgcgctctttgagattcgtcggaacacatgataatag
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 48339-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 48339-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
5HT6-YC3.60 was a gift from Takanari Inoue (Addgene plasmid # 48339 ; http://n2t.net/addgene:48339 ; RRID:Addgene_48339) -
For your References section:
Genetically encoded calcium indicator illuminates calcium dynamics in primary cilia. Su S, Phua SC, Derose R, Chiba S, Narita K, Kalugin PN, Katada T, Kontani K, Takeda S, Inoue T. Nat Methods. 2013 Sep 22. doi: 10.1038/nmeth.2647. 10.1038/nmeth.2647 PubMed 24056873