Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

5HT6-CFP-Venus(H148G)
(Plasmid #47501)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 47501 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pECFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 6700
  • Modifications to backbone
    DNA encoding 5HT6 flanked by NheI and AgeI was amplified by PCR from 5HT6-GFP and then subcloned into pECFP vector (Clontech).
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Venus(H148G)
  • Species
    Synthetic
  • Insert Size (bp)
    720
  • Mutation
    H148G mutation
  • Tags / Fusion Proteins
    • 5HT6 (N terminal on backbone)
    • CFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer None
  • 3′ sequencing primer CCTCTACAAATGTGGTATGGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    5HT6-CFP-Venus(H148G) was a gift from Takanari Inoue (Addgene plasmid # 47501 ; http://n2t.net/addgene:47501 ; RRID:Addgene_47501)
  • For your References section:

    Genetically encoded calcium indicator illuminates calcium dynamics in primary cilia. Su S, Phua SC, Derose R, Chiba S, Narita K, Kalugin PN, Katada T, Kontani K, Takeda S, Inoue T. Nat Methods. 2013 Sep 22. doi: 10.1038/nmeth.2647. 10.1038/nmeth.2647 PubMed 24056873