5HT6-YC3.60
(Plasmid
#48339)
-
PurposeFRET reporter for Ca2+ inside primary cilia
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 48339 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3
- Backbone size w/o insert (bp) 5300
- Total vector size (bp) 6650
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name5-hydroxytriptamine receptor isoform 6
-
Alt name5HT6
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1350
-
GenBank IDNM_021358
-
Entrez GeneHtr6 (a.k.a. 5-HT6)
-
Tag
/ Fusion Protein
- YC3.60 (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GGAGGTCTATATAAGCAGAGC
- 3′ sequencing primer gcacctaagctttcctcctgcgcttcctcctgcgctctttgagattcgtcggaacacatgataatag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
5HT6-YC3.60 was a gift from Takanari Inoue (Addgene plasmid # 48339 ; http://n2t.net/addgene:48339 ; RRID:Addgene_48339) -
For your References section:
Genetically encoded calcium indicator illuminates calcium dynamics in primary cilia. Su S, Phua SC, Derose R, Chiba S, Narita K, Kalugin PN, Katada T, Kontani K, Takeda S, Inoue T. Nat Methods. 2013 Sep 22. doi: 10.1038/nmeth.2647. 10.1038/nmeth.2647 PubMed 24056873