pDS69
(Plasmid #48367)

• Purpose: FLAG-intergenic region of TUB-HYG (modified from PMID 16269191)
• Depositing Lab: George Cross
• Publication: Kim et al Mol Biochem Parasitol. 2013 Aug 13;191(1):16-19. doi: 10.1016/j.molbiopara.2013.08.001.

Backbone

• Vector backbone: pGEM-T Easy
• Backbone manufacturer: Promega
• Total vector size (bp): 4500
• Vector type: Cre/Lox ; Knockout in T. Brucei
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: FLAG-intergenic region of TUB-HYG (modified from PMID 16269191)
• Species: T. brucei

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: tb#44 CTGGTTAGTATGGACTTCTCTAGA
• 3′ sequencing primer: pBRrevBam

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For additional information, see http://tryps.rockefeller.edu/trypsru2_cre-lox.html

There are several mismatches between Addgene's quality control sequence and the reference sequence from the depositing lab. These mismatches should not affect plasmid function.