PM-TD!TB
(Plasmid
#48656)
-
PurposeBacterial TD crRNA expression: targets TD to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol
-
Depositing Lab
-
Depositing OrganizationHarvard Medical School
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 48656 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 48656-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 48656-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonep15A-cat
- Total vector size (bp) 2756
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBacterial TD crRNA to prototspacer B
-
SpeciesSynthetic
-
Insert Size (bp)66
- Promoter J23100 promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer p15A-F
- 3′ sequencing primer CAT-R
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 48656-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 48656-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PM-TD!TB was a gift from George Church (Addgene plasmid # 48656 ; http://n2t.net/addgene:48656 ; RRID:Addgene_48656) -
For your References section:
Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Esvelt KM, Mali P, Braff JL, Moosburner M, Yaung SJ, Church GM. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. 10.1038/nmeth.2681 PubMed 24076762