Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Orthogonal Cas9 proteins for RNA-guided gene regulation and editing.
Esvelt KM, Mali P, Braff JL, Moosburner M, Yaung SJ, Church GM
Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681.
PubMed Article

Plasmids from Article

ID Plasmid Purpose  
48645DS-SPcasBacterial S. pyogenes Cas9 (SP) + tracrRNA expression, cloDF13/spectinomycin
Loading...
48646DS-NMcasBacterial N. meningitidis Cas9 (NM) + tracrRNA expression, cloDF13/spectinomycin
Loading...
48647DS-ST1casBacterial S. thermophilus #1 Cas9 (ST1) + tracrRNA expression, cloDF13/spectinomycin
Loading...
48649PM-SP!TABacterial SP crRNA expression: targets SP to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol
Loading...
48650PM-SP!TBBacterial SP crRNA expression: targets SP to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol
Loading...
48651PM-NM!TABacterial NM crRNA expression: targets NM to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol
Loading...
48652PM-NM!TBBacterial NM crRNA expression: targets NM to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol
Loading...
48653PM-ST1!TABacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol
Loading...
48654PM-ST1!TBBacterial ST1 crRNA expression: targets ST1 to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol
Loading...
48655PM-TD!TABacterial TD crRNA expression: targets TD to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol
Loading...
48656PM-TD!TBBacterial TD crRNA expression: targets TD to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol
Loading...
48659DS-ST1casN-Bacterial nuclease-null ST1 Cas9 expression
Loading...
48660DS-TDcasN-Bacterial nuclease-null TD Cas9 expression
Loading...
48661SK-YFP-SPNM-BBacterial SP and NM repression YFP reporter: protospacer B
Loading...
48662SK-YFP-ST1-BBacterial ST1 repression YFP reporter: protospacer B
Loading...
48663SK-YFP-TD-BBacterial TD repression YFP reporter: protospacer B
Loading...
48664SK-YFP-NM-ABacterial NM repression YFP reporter: protospacer A
Loading...
48665SK-YFP-ST1-ABacterial ST1 repression YFP reporter: protospacer A
Loading...
48666SK-YFP-TD-ABacterial TD repression YFP reporter: protospacer A
Loading...
48667EE-SP!gIIIBacterial SP Cas9 targeting filamentous phage gene III at five protospacers
Loading...
48668M-SPcasMammalian S. pyogenes Cas9 expression, human optimized
Loading...
48669M-ST1casMammalian S. thermophilus #1 Cas9 expression, human optimized
Loading...
48670M-NMcasMammalian N. meningitidis Cas9 expression, human optimized
Loading...
48671M-SP-sgRNAMammalian U6-driven sgRNA (SPm) targeting GTCCCCTCCACCCCACAGTG
Loading...
48672M-ST1-sgRNAMammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTG
Loading...
48673M-NM-sgRNAMammalian U6-driven sgRNA (NMm1) targeting GTCCCCTCCACCCCACAGTG
Loading...
48674M-SPn-VP64Mammalian SP-VP64 nuclease-null Cas9 activator expression, human optimized
Loading...
48675M-ST1n-VP64Mammalian ST1-VP64 nuclease-null Cas9 activator expression, human optimized
Loading...
48676M-NMn-VP64Mammalian NM-VP64 nuclease-null Cas9 activator expression, human optimized
Loading...
48677M-tdTom-SPMammalian tdTomato activation reporter for SP with GTCCCCTCCACCCCACAGTG protospacer
Loading...
48678M-tdTom-ST1Mammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG protospacer
Loading...
48679M-tdTom-NMMammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG protospacer
Loading...