Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Orthogonal Cas9 proteins for RNA-guided gene regulation and editing.
Esvelt KM, Mali P, Braff JL, Moosburner M, Yaung SJ, Church GM
Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681.
PubMed Article

Plasmids from Article

ID Plasmid Purpose  
48645DS-SPcasBacterial S. pyogenes Cas9 (SP) + tracrRNA expression, cloDF13/spectinomycin
48646DS-NMcasBacterial N. meningitidis Cas9 (NM) + tracrRNA expression, cloDF13/spectinomycin
48647DS-ST1casBacterial S. thermophilus #1 Cas9 (ST1) + tracrRNA expression, cloDF13/spectinomycin
48649PM-SP!TABacterial SP crRNA expression: targets SP to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol
48650PM-SP!TBBacterial SP crRNA expression: targets SP to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol
48651PM-NM!TABacterial NM crRNA expression: targets NM to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol
48652PM-NM!TBBacterial NM crRNA expression: targets NM to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol
48653PM-ST1!TABacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol
48654PM-ST1!TBBacterial ST1 crRNA expression: targets ST1 to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol
48655PM-TD!TABacterial TD crRNA expression: targets TD to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol
48656PM-TD!TBBacterial TD crRNA expression: targets TD to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol
48659DS-ST1casN-Bacterial nuclease-null ST1 Cas9 expression
48660DS-TDcasN-Bacterial nuclease-null TD Cas9 expression
48661SK-YFP-SPNM-BBacterial SP and NM repression YFP reporter: protospacer B
48662SK-YFP-ST1-BBacterial ST1 repression YFP reporter: protospacer B
48663SK-YFP-TD-BBacterial TD repression YFP reporter: protospacer B
48664SK-YFP-NM-ABacterial NM repression YFP reporter: protospacer A
48665SK-YFP-ST1-ABacterial ST1 repression YFP reporter: protospacer A
48666SK-YFP-TD-ABacterial TD repression YFP reporter: protospacer A
48667EE-SP!gIIIBacterial SP Cas9 targeting filamentous phage gene III at five protospacers
48668M-SPcasMammalian S. pyogenes Cas9 expression, human optimized
48669M-ST1casMammalian S. thermophilus #1 Cas9 expression, human optimized
48670M-NMcasMammalian N. meningitidis Cas9 expression, human optimized
48671M-SP-sgRNAMammalian U6-driven sgRNA (SPm) targeting GTCCCCTCCACCCCACAGTG
48672M-ST1-sgRNAMammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTG
48673M-NM-sgRNAMammalian U6-driven sgRNA (NMm1) targeting GTCCCCTCCACCCCACAGTG
48674M-SPn-VP64Mammalian SP-VP64 nuclease-null Cas9 activator expression, human optimized
48675M-ST1n-VP64Mammalian ST1-VP64 nuclease-null Cas9 activator expression, human optimized
48676M-NMn-VP64Mammalian NM-VP64 nuclease-null Cas9 activator expression, human optimized
48677M-tdTom-SPMammalian tdTomato activation reporter for SP with GTCCCCTCCACCCCACAGTG protospacer
48678M-tdTom-ST1Mammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG protospacer
48679M-tdTom-NMMammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG protospacer

Recombinant Antibodies from Article