PM-ST1!TA
(Plasmid
#48653)
-
PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 48653 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonep15A-cat
- Total vector size (bp) 2756
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBacterial ST1 crRNA to prototspacer A
-
SpeciesSynthetic
-
Insert Size (bp)66
- Promoter J23100 promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer p15A-F
- 3′ sequencing primer CAT-R (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PM-ST1!TA was a gift from George Church (Addgene plasmid # 48653 ; http://n2t.net/addgene:48653 ; RRID:Addgene_48653) -
For your References section:
Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Esvelt KM, Mali P, Braff JL, Moosburner M, Yaung SJ, Church GM. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. 10.1038/nmeth.2681 PubMed 24076762