Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

EGFP-Rab6A
(Plasmid #49469)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 49469 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    EGFP C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 5320
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rab6A
  • Alt name
    Rab6A isoform b
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    627
  • GenBank ID
  • Entrez Gene
    RAB6A (a.k.a. RAB6)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI/BglII (destroyed during cloning)
  • 3′ cloning site XhoI/SalI (destroyed during cloning)
  • 5′ sequencing primer EGFP C (CATGGTCCTGCTGGAGTTCGTG)
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EGFP-Rab6A was a gift from Marci Scidmore (Addgene plasmid # 49469 ; http://n2t.net/addgene:49469 ; RRID:Addgene_49469)
  • For your References section:

    Rab GTPases are recruited to chlamydial inclusions in both a species-dependent and species-independent manner. Rzomp KA, Scholtes LD, Briggs BJ, Whittaker GR, Scidmore MA. Infect Immun. 2003 Oct;71(10):5855-70. 10.1128/IAI.71.10.5855-5870.2003 PubMed 14500507