EGFP-BICD1
(Plasmid #49487)

• Purpose: expresses EGFP-BICD1 in mammalian cells
• Depositing Lab: Marci Scidmore
• Publication: Moorhead et al Infect Immun. 2007 Feb;75(2):781-91. Epub 2006 Nov 13.

Backbone

• Vector backbone: EGFP C2
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4371
• Total vector size (bp): 7641
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: BICD1
• Alt name: bicaudal D1
• Species: H. sapiens (human)
• Insert Size (bp): 2937
• Mutation: ** see notes
• GenBank ID: NM_001003398.1
• Entrez Gene: BICD1 (a.k.a. BICD, bic-D 1)
• Promoter: CMV
• Tag / Fusion Protein:
  • EGFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI/BglII (destroyed during cloning)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: EGFP C (CATGGTCCTGCTGGAGTTCGTG)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

PCR from HeLa cDNA with 5' BamHI Linkers plus 2 additional AA prior to ATG) and 3' SalI linkers cloned into BglII/SalI sites of EGFP C2

**From the associated publication: "Upon DNA sequencing, it was determined that amino acids 821 to 920 were deleted from ... EGFP-BICD1."