Skip to main content

pEGFP Vinculin
(Plasmid #50513)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 50513 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pEGFPNBC1
  • Backbone manufacturer
    Yamada lab
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Vinculin
  • Alt name
    VCL
  • Alt name
    focal adhesion protein
  • Species
    G. gallus (chicken)
  • Entrez Gene
    VCL (a.k.a. VINC1)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer EGFP FW (CATGGTCCTGCTGGAGTTCGTG)
  • 3′ sequencing primer EGFP RVs (CTCTACAAATGTGGTATGGCTG)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

modification of Clontech pEGFPC1 MCS

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP Vinculin was a gift from Kenneth Yamada (Addgene plasmid # 50513 ; http://n2t.net/addgene:50513 ; RRID:Addgene_50513)