Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pmCherry Vinculin
(Plasmid #50527)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 50527 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Vinculin
  • Alt name
    VCL
  • Alt name
    focal adhesion protein
  • Species
    G. gallus (chicken)
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer mCherry FW (CACAACGAGGACTACACCATC)
  • 3′ sequencing primer EGFP RVs (CTCTACAAATGTGGTATGGCTG)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Replacement of Clontech pEGFP C1 vector EGFP with mCherry and MCS modification with Bam HI mutation of original Bam H I.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmCherry Vinculin was a gift from Kenneth Yamada (Addgene plasmid # 50527 ; http://n2t.net/addgene:50527 ; RRID:Addgene_50527)