Skip to main content

GANLS-DEVD-BNES
(Plasmid #50835)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 50835 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 50835-D50 50 μg of DNA in Tris buffer $495
DNA 50835-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5500
  • Total vector size (bp) 7021
  • Modifications to backbone
    Multi cloning sites has been replaced by a customized sequence, which is compatible to the reading frame of vector pBAD hisB.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ddGFP A and ddRFP B
  • Alt name
    dimerization dependent green fluorescent protein (ddGFP)
  • Alt name
    dimerization dependent green red fluorescent protein (ddRFP)
  • Species
    Synthetic; synthetic construct
  • Insert Size (bp)
    1521
  • GenBank ID
    KF976774
  • Promoter CMV
  • Tags / Fusion Proteins
    • triplicated NLS sequence DPKKKRKV placed after ddGFP A
    • NES sequence LALKLAGLDIGS (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GANLS-DEVD-BNES was a gift from Robert Campbell (Addgene plasmid # 50835 ; http://n2t.net/addgene:50835 ; RRID:Addgene_50835)
  • For your References section:

    Ratiometric biosensors based on dimerization-dependent fluorescent protein exchange. Ding Y, Li J, Enterina JR, Shen Y, Zhang I, Tewson PH, Mo GC, Zhang J, Quinn AM, Hughes TE, Maysinger D, Alford SC, Zhang Y, Campbell RE. Nat Methods. 2015 Jan 26. doi: 10.1038/nmeth.3261. 10.1038/nmeth.3261 PubMed 25622108