pCMV-myc-Sema4D-CD4-FLAG
(Plasmid #51601)

• Purpose: expresses non-cleavable Sema4D/CD4 chimera with extracellular Sema4D, intracellular CD4
• Depositing Lab: Suzanne Paradis
• Depositing Organization: Brandeis University
  Located in United States of America
• Publication: Raissi et al Mol Cell Neurosci. 2013 Nov;57:23-32. doi: 10.1016/j.mcn.2013.08.004. Epub 2013 Sep 10.

Backbone

• Vector backbone: pCMV
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 6100
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Sema4D/CD4-FLAG
• Species: H. sapiens (human), M. musculus (mouse)
• Insert Size (bp): 2100
• Mutation: Sema4D amino acids 660-861 were replaced with CD4 amino acids 378-458.silent mutations between amino acids (approx 275-281) to make resistant against shRNA1. Also silent mutation at aa 54-60 to make susceptible to shRNA2.
• GenBank ID: NM_001281880
• Entrez Gene: Sema4d (a.k.a. CD100, Semacl2, Semaj, Semcl2, coll-4)
• Promoter: CMV
• Tags / Fusion Proteins:
  • myc (N terminal on insert)
  • FLAG (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (unknown if destroyed)
• 3′ cloning site: NotI (unknown if destroyed)
• 5′ sequencing primer: TGTCAAGTTCAGGTGGTCACAGG
• 3′ sequencing primer: GCGGAACTCAAATGTTTCCAAAAG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that the sequence of the myc epitope tag in this plasmid is MQKLISEEDLL, which differs from the standard EQKLISEEDLL.

The Sema4D insert in this plasmid does not contain amino acids 1-50 of GenBank reference sequence NP_542764.2.

DNA (Catalog # 51601-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 51601-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.