Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24 - January 1, 2020. For more information, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #51604)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 51604 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 5300
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    CD4 (a.k.a. CD4mut)
  • Promoter CMV
  • Tags / Fusion Proteins
    • FLAG (C terminal on insert)
    • myc (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer gagacacggagagggtcttc
  • 3′ sequencing primer CATTCTAGTTGTGGTTTGTCC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

Please note that the sequence of the myc epitope tag in this plasmid is MQKLISEEDLL, which differs from the standard EQKLISEEDLL.

The CD4 insert in this plasmid contains N64I and K385E mutations when compared to GenBank reference sequence NP_038688.2.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-CD4-FLAG was a gift from Suzanne Paradis (Addgene plasmid # 51604 ; ; RRID:Addgene_51604)
  • For your References section:

    Sema4D localizes to synapses and regulates GABAergic synapse development as a membrane-bound molecule in the mammalian hippocampus. Raissi AJ, Staudenmaier EK, David S, Hu L, Paradis S. Mol Cell Neurosci. 2013 Nov;57:23-32. doi: 10.1016/j.mcn.2013.08.004. Epub 2013 Sep 10. 10.1016/j.mcn.2013.08.004 PubMed 24036351