pTT5-hSDC1-N20
(Plasmid
#52355)
-
Purposeexpresses human syndecan 1 'del 1- 20' truncation mutant in HEK293-EBNA1 (293E) suspension culture.
-
Depositing Lab
-
Depositing OrganizationUniversity of Virginia
Located in United States of America -
Citations
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 52355 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 52355-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 52355-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepTT5
-
Backbone manufacturerNRC Biotechnology Research Institute
- Backbone size w/o insert (bp) 4401
- Total vector size (bp) 5300
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSDC1
-
Alt nameSyndecan-1 N20 or 'del 1- 20' truncation mutant
-
SpeciesH. sapiens (human)
-
Insert Size (bp)873
-
MutationDeletion of SDC1 aa2-21 (according to numbering in Fig. 2A of associated publication) and replaced with GS; R117Q (R95Q numbering as in Fig. 2A)
-
Entrez GeneSDC1 (a.k.a. CD138, SDC, SYND1, syndecan)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer CCATACACTTGAGTGACAATGAC
- 3′ sequencing primer TATGTCCTTCCGAGTGAGAG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypTT5 backbone used in his plasmids was obtained from Yves Durocher at National Research Council of Canada (NRC)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 52355-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 52355-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTT5-hSDC1-N20 was a gift from Gordon Laurie (Addgene plasmid # 52355 ; http://n2t.net/addgene:52355 ; RRID:Addgene_52355) -
For your References section:
Targeting of heparanase-modified syndecan-1 by prosecretory mitogen lacritin requires conserved core GAGAL plus heparan and chondroitin sulfate as a novel hybrid binding site that enhances selectivity. Zhang Y, Wang N, Raab RW, McKown RL, Irwin JA, Kwon I, van Kuppevelt TH, Laurie GW. J Biol Chem. 2013 Apr 26;288(17):12090-101. doi: 10.1074/jbc.M112.422717. Epub 2013 Mar 15. 10.1074/jbc.M112.422717 PubMed 23504321
Map uploaded by the depositor.