-
Purposeserves as template for PCR-mediated fusion of U6-promoter with sgRNA
-
Depositing Lab
-
Depositing OrganizationLudwig-Maximilians-Universitaet Muenchen (LMU)
Located in Germany -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 52527 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepJet1.2
-
Backbone manufacturerThermor Fisher / Fermentas
- Backbone size w/o insert (bp) 2972
- Total vector size (bp) 3407
-
Vector typeInsect Expression, CRISPR ; blunt cloning kit
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDrosophila U6C promoter
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)435
-
Tag
/ Fusion Protein
- T7-promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer taatacgactcactataggg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Depositor states that there may are additional non-annotated NcoI sites in the backbone. Digest results may not accurately reflect full plasmid sequence provided. Depositor states that the plasmid should function normally despite this discrepancy.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRB17 was a gift from Klaus Foerstemann (Addgene plasmid # 52527 ; http://n2t.net/addgene:52527 ; RRID:Addgene_52527) -
For your References section:
Efficient chromosomal gene modification with CRISPR/cas9 and PCR-based homologous recombination donors in cultured Drosophila cells. Bottcher R, Hollmann M, Merk K, Nitschko V, Obermaier C, Philippou-Massier J, Wieland I, Gaul U, Forstemann K. Nucleic Acids Res. 2014 Apr 19. 10.1093/nar/gku289 PubMed 24748663