pGLx2-SET1
(Plasmid
#53256)
-
PurposeGAL driven LexA-tagged SET1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 53256 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGLx2
- Backbone size w/o insert (bp) 6442
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSET1
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)3240
-
Tag
/ Fusion Protein
- LexA (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SmaI (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer cagggcaataaagtcgaact (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGLx2-SET1 was a gift from Jean Cook (Addgene plasmid # 53256 ; http://n2t.net/addgene:53256 ; RRID:Addgene_53256) -
For your References section:
DNA replication origin function is promoted by H3K4 di-methylation in Saccharomyces cerevisiae. Rizzardi LF, Dorn ES, Strahl BD, Cook JG. Genetics. 2012 Oct;192(2):371-84. doi: 10.1534/genetics.112.142349. Epub 2012 Jul 30. 10.1534/genetics.112.142349 PubMed 22851644
