Skip to main content

pMiR-E6AP-3'UTR
(Plasmid #53694)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 53694 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 53694-D50 50 μg of DNA in Tris buffer $495
DNA 53694-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pMiR-Target
  • Backbone manufacturer
    Origene
  • Backbone size w/o insert (bp) 7900
  • Total vector size (bp) 9800
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    UBE3A 3'UTR
  • Alt name
    E6AP
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1896
  • GenBank ID
    NM_000462.3
  • Entrez Gene
    UBE3A (a.k.a. ANCR, AS, E6-AP, EPVE6AP, HPVE6A, PIX1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR1 (not destroyed)
  • 3′ cloning site Not1 (not destroyed)
  • 5′ sequencing primer AGAAGCTGCGCGGTGGTGTTGTG
  • 3′ sequencing primer CTGGAGGATCATCCAGCCGGCGT
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMiR-E6AP-3'UTR was a gift from Edward Chan (Addgene plasmid # 53694 ; http://n2t.net/addgene:53694 ; RRID:Addgene_53694)
  • For your References section:

    miR-375 activates p21 and suppresses telomerase activity by coordinately regulating HPV E6/E7, E6AP, CIP2A, and 14-3-3zeta. Jung HM, Phillips BL, Chan EK. Mol Cancer. 2014 Apr 8;13(1):80. doi: 10.1186/1476-4598-13-80. 10.1186/1476-4598-13-80 PubMed 24708873