Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pOTTC468 - pAAV EF1a DIO hChR2(H134R)-iRFP
(Plasmid #47633)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 47633 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV EF1a DIO
  • Backbone manufacturer
    Karl Deisseroth
  • Backbone size w/o insert (bp) 5637
  • Modifications to backbone
    inserted a C between lox2722 and NheI restriction site to disrupt a synthetic start codon in the 5'UTR.
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hChR2 (H134R)
  • Alt name
    Channel Rhodopsin 2
  • Species
    C. reinhardtii
  • Mutation
    H134R
  • GenBank ID
    EF474017
  • Promoter EF1a
  • Tag / Fusion Protein
    • iRFP (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer EF1a_F1 (5'-CAAGCCTCAGACAGTGGTTC)
  • 3′ sequencing primer WPRE_R1 (5'ATGAAAGCCATACGGGAAGC)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    the ORF for iRFP was obtained from Addgene (Plasmid 31857). the ORF for hChR2H134R) was from Karl Deisseroth, but is also available from Addgene (Plasmid 20297). the backbone was obtained from Karl Deisseroth, but is also available from Addgene (Plasmid 35507).
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOTTC468 - pAAV EF1a DIO hChR2(H134R)-iRFP was a gift from Brandon Harvey (Addgene plasmid # 47633 ; http://n2t.net/addgene:47633 ; RRID:Addgene_47633)
  • For your References section:

    Near-infrared fluorescent protein iRFP713 as a reporter protein for optogenetic vectors, a transgenic Cre-reporter rat, and other neuronal studies. Richie CT, Whitaker LR, Whitaker KW, Necarsulmer J, Baldwin HA, Zhang Y, Fortuno L, Hinkle JJ, Koivula P, Henderson MJ, Sun W, Wang K, Smith JC, Pickel J, Ji N, Hope BT, Harvey BK. J Neurosci Methods. 2017 Jun 1;284:1-14. doi: 10.1016/j.jneumeth.2017.03.020. Epub 2017 Apr 2. 10.1016/j.jneumeth.2017.03.020 PubMed 28380331